Você pode escrever um script para fazer isso diretamente, mas sugiro que use os dois pequenos scripts abaixo. Eu passei muitos anos trabalhando com esse tipo de dados e eles foram muito, muito úteis. Se você está planejando fazer muita manipulação de arquivos FASTA, sugiro que você os use.
-
FastaToTbl:#!/usr/bin/awk -f { if (substr($1,1,1)==">") if (NR>1) printf "\n%s\t", substr($0,2,length($0)-1) else printf "%s\t", substr($0,2,length($0)-1) else printf "%s", $0 }END{printf "\n"} -
TblToFasta:#! /usr/bin/awk -f { sequence=$NF ls = length(sequence) is = 1 fld = 1 while (fld < NF) { if (fld == 1){printf ">"} printf "%s " , $fld if (fld == NF-1) { printf "\n" } fld = fld+1 } while (is <= ls) { printf "%s\n", substr(sequence,is,60) is=is+60 } }
Salve os scripts acima no diretório $HOME/bin (se ele não existir, crie-o, efetue logout e faça login novamente para adicioná-lo ao seu $PATH ). Em seguida, torne os scripts executáveis com chmod a+x ~/bin/TblToFasta ~/bin/FastaToTbl .
O FastaToTbl converterá os arquivos de sequência FASTA para o formato tbl (o ID da sequência, seguido por um caractere de tabulação e a sequência, tudo em uma linha). Quando eles estiverem no formato tbl e você tiver o ID e a sequência na mesma linha, use grep para pesquisar seus IDs. Então, você passa a saída através de TblToFasta para converter de volta para FASTA:
$ FastaToTbl file2 | grep -wFf file1 | TblToFasta
>AAX50250.1 cds:annotated chromosome:ASM1212v1:Chromosome:1:1770:1 gene:CTA_0001.1 gene_biotype:protein_coding transcript_biotype:protein_coding description:hypothetical protein
ATGAGCATCAGGGGAGTAGGAGGCAACGGGAATAGTCGAATCCCTTCTCATAATGGGGAT
GGATCGAATCGCAGAAGTCAAAATACGAAGAATAAAGTTGAAGATCGAGTTCGTTCTCTA
TATTCATCTCGTAGTAACGAAAATAGAGAATCTCCTTATGCAGTAGTAGACGTCAGCTCT
>AAX50251.1 cds:annotated chromosome:ASM1212v1:Chromosome:1915:2187:-1 gene:CTA_0002.1 gene_biotype:protein_coding transcript_biotype:protein_coding description:hypothetical membrane associated protein
ATGCTTTGTAAAGTTTGTAGAGGATTATCTTCTCTTATTGTTGTTCTCGGAGCTATAAAC
ACTGGAATTTTAGGAGTAACAGGGTATAAGGTAAACCTACTTACTCACCTGCTTGGTGAA
GGAACCATGTGGACACAAGCAGCTTATGTAGTAACGGGAATCGCTGGGGTTATGGTCTGC
>AAX50252.1 cds:annotated chromosome:ASM1212v1:Chromosome:2388:2690:1 gene:CTA_0003.1 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:gatC description:glutamyl-tRNA(Gln) amidotransferase subunit C
ATGACAGAGTCATATGTAAACAAAGAAGAAATCATCTCTTTAGCAAAGAATGCTGCATTG
GAGTTGGAAGATGCCCACGTGGAAGAGTTCGTAACATCTATGAATGACGTCATTGCTTTA
ATGCAGGAAGTAATCGCGATAGATATTTCGGATATCATTCTTGAAGCTACAGTGCATCAT
TTCGTTGGTCCAGAGGATCTTAGAGAAGACATGGTGACTTCGGATTTTACTCAAGAAGAA
TAG
As opções grep usadas são:
-F, --fixed-strings
Interpret PATTERN as a list of fixed strings (instead of regular
expressions), separated by newlines, any of which is to be matched.
-f FILE, --file=FILE
Obtain patterns from FILE, one per line. If this option is used
multiple times or is combined with the -e (--regexp) option, search
for all patterns given. The empty file contains zero patterns, and
therefore matches nothing.
-w, --word-regexp
Select only those lines containing matches that form whole words.
The test is that the matching substring must either be at the
beginning of the line, or preceded by a non-word constituent
character. Similarly, it must be either at the end of the line or
followed by a non-word constituent character. Word-constituent
characters are letters, digits, and the underscore.
Assim, o -f nos permite fornecer um arquivo para ler a pesquisa [padrões de, o -F diz para tratar os padrões como sequências de caracteres e não expressões regulares (caso contrário, seus IDs contêm . , que eles costumam fazer, que serão considerados como "correspondem a qualquer caractere") e o -w garante que correspondamos somente a ID inteira, de forma que foo não corresponda a foobar .
Alternativamente, aqui está um perl rápido e sujo para fazer o que você quer:
perl -e 'open(F,"File1.txt");while(<F>){/(\S+)/; $k{$1}++}; while(<>){if(/>\s*(\S+?)(\.| )/){if($k{$1}){$k=1}else{$k=0}; } print if $k==1;}' File2.fa
Ou, um pouco menos sujo:
perl -e 'open(F,"File1.txt");
while(<F>){
/(\S+)/;
$k{$1}++
}
while(<>){
if(/>\s*(\S+?)(\.| )/){
if($k{$1}){$k=1}
else{$k=0}
}
print if $k==1
}' File2.fa