O caso simples que você mostra é trivial. As suas sequências nunca são mais do que uma única linha, pelo que pode simplesmente utilizar grep para procurar cada um dos seus IDs e a linha depois deles:
grep -Fwf list.txt -A 1 seq.fasta | grep -v '^--$' > out.fasta
O grep -v '^--$' simplesmente filtra as linhas com -- que grep adiciona entre grupos de linhas de saída ao usar a opção -A .
Para evitar os enganos, você pode passar sua lista por meio da classificação (GNU):
grep -Fwf <(sort -u list.txt) -A 1 seq.fasta | grep -v '^--$' > out.fasta
As bandeiras usadas são:
-f FILE, --file=FILE
Obtain patterns from FILE, one per line. The empty file
contains zero patterns, and therefore matches nothing. (-f is
specified by POSIX.)
-w, --word-regexp
Select only those lines containing matches that form whole
words. The test is that the matching substring must either be
at the beginning of the line, or preceded by a non-word
constituent character. Similarly, it must be either at the end
of the line or followed by a non-word constituent character.
Word-constituent characters are letters, digits, and the
underscore.
-F, --fixed-strings
Interpret PATTERN as a list of fixed strings, separated by
newlines, any of which is to be matched. (-F is specified by
POSIX.)
-A NUM, --after-context=NUM
Print NUM lines of trailing context after matching lines.
Places a line containing a group separator (--) between
contiguous groups of matches. With the -o or --only-matching
option, this has no effect and a warning is given.
No entanto, na maioria dos casos, suas seqüências serão várias linhas e isso não será suficiente. Se você fizer esse tipo de coisa com frequência, sugiro instalar o conjunto de ferramentas exonerate . Eles são geralmente extremamente úteis para o trabalho de bioinformática e incluem uma boa ferramenta chamada fastafetch que é projetada para fazer exatamente o que você quer:
-
Instale o pacote exonerado. Isso está nos repositórios dos sistemas baseados em Debian, e também está disponível em aqui .
sudo apt-get install exonerate -
Crie um índice para o seu arquivo fasta. Isso é usado para a rápida recuperação de seqüências.
fastaindex seq.fasta seq.idx -
Extraia suas seqüências:
$ fastafetch -f seq.fasta -i seq.idx -Fq <(sort -u list.txt ) >3566454__len__1744 GGTTTGTAAGACCGTAGAGGGTTTGTAAGACCGTAGAG >58759__len__2903 TTTTCCGTAGAGGAGATCCCTATTTTTAGGTTTGTAAGAGATCATTTT >673957__len__1655 CCCTATTTTTAGGTTTGTAAGGTTTGTAAGACCGTAGAG
Como uma nota lateral, eu escrevi um script que pode fazer isso e um pouco mais. Pode levar uma ou mais listas de IDs de entrada e extrairá as seqüências correspondentes de um arquivo multi-fasta. Pode imprimir em STDOUT ou criar um arquivo para cada lista de entrada. Você pode encontrá-lo aqui .